ID: 907190278_907190290

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 907190278 907190290
Species Human (GRCh38) Human (GRCh38)
Location 1:52642230-52642252 1:52642273-52642295
Sequence CCCTGGGGTGGGAGCAGGTGAGG TGGTGCTGCTGAGCGGGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 58, 4: 602} {0: 1, 1: 0, 2: 1, 3: 21, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!