ID: 907211825_907211830

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 907211825 907211830
Species Human (GRCh38) Human (GRCh38)
Location 1:52830293-52830315 1:52830334-52830356
Sequence CCTCTTTTATTCTAAACCATGGA ATGTCCTGGTAGAAGAGTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 18, 3: 46, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!