ID: 907239576_907239581

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 907239576 907239581
Species Human (GRCh38) Human (GRCh38)
Location 1:53074147-53074169 1:53074162-53074184
Sequence CCTGACACATCTGCCAGATGGAG AGATGGAGCAGGGGTGAGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 6, 3: 138, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!