ID: 907240255_907240263

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 907240255 907240263
Species Human (GRCh38) Human (GRCh38)
Location 1:53077324-53077346 1:53077338-53077360
Sequence CCCTGTACAAGCTGCACCTCAAG CACCTCAAGGTGGGCAGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 99} {0: 1, 1: 0, 2: 1, 3: 30, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!