ID: 907240823_907240833

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 907240823 907240833
Species Human (GRCh38) Human (GRCh38)
Location 1:53080126-53080148 1:53080167-53080189
Sequence CCCCTGGATGCCAGGCATGTGAT CTGGGGCCTGGCTGTTGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 198} {0: 1, 1: 0, 2: 7, 3: 44, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!