ID: 907265564_907265573

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 907265564 907265573
Species Human (GRCh38) Human (GRCh38)
Location 1:53258224-53258246 1:53258253-53258275
Sequence CCAGCAGCATACTGTGTCCCAGA GGGAAGATTTCAGCAGGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 140} {0: 1, 1: 0, 2: 0, 3: 26, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!