ID: 907275801_907275808

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 907275801 907275808
Species Human (GRCh38) Human (GRCh38)
Location 1:53316015-53316037 1:53316054-53316076
Sequence CCACTCTGCCCTGGTTTGCTTGG AAGAAGAACCGACTGGCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 284} {0: 1, 1: 0, 2: 1, 3: 3, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!