ID: 907305287_907305302

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 907305287 907305302
Species Human (GRCh38) Human (GRCh38)
Location 1:53509759-53509781 1:53509794-53509816
Sequence CCCCCACTAGGTCACTGTCTCCT GTCCCTAAGTGGGAATTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 19, 4: 273} {0: 1, 1: 0, 2: 2, 3: 5, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!