ID: 907321568_907321576

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 907321568 907321576
Species Human (GRCh38) Human (GRCh38)
Location 1:53606043-53606065 1:53606083-53606105
Sequence CCTTCTGAGCCTCAGTTTCTTCA AGAATCCCAGCTCCAGGGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 50, 4: 677}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!