ID: 907328747_907328755

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 907328747 907328755
Species Human (GRCh38) Human (GRCh38)
Location 1:53657881-53657903 1:53657919-53657941
Sequence CCTTGCCCCTTCTCTGCACCCTC TCAGCCTCATCCTCTCAGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 40, 4: 397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!