ID: 907379399_907379404

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 907379399 907379404
Species Human (GRCh38) Human (GRCh38)
Location 1:54073428-54073450 1:54073470-54073492
Sequence CCCTCCTCGCTACTGGCCCACAG TGCTATTGATATCAGCCCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 173} {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!