ID: 907395154_907395158

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 907395154 907395158
Species Human (GRCh38) Human (GRCh38)
Location 1:54184542-54184564 1:54184566-54184588
Sequence CCATGCAGGTACCATAAATGAGT AAGAACTGGGTGATGATTAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 30, 4: 187} {0: 1, 1: 0, 2: 1, 3: 19, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!