ID: 907395154_907395159

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 907395154 907395159
Species Human (GRCh38) Human (GRCh38)
Location 1:54184542-54184564 1:54184593-54184615
Sequence CCATGCAGGTACCATAAATGAGT TAACACACAGTCTCAGCATCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 30, 4: 187} {0: 1, 1: 0, 2: 0, 3: 16, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!