ID: 907404453_907404460

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 907404453 907404460
Species Human (GRCh38) Human (GRCh38)
Location 1:54245371-54245393 1:54245390-54245412
Sequence CCGGCCCCCCAGATTCTGTATGC ATGCTTAGCCAAGAAACTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 166} {0: 1, 1: 0, 2: 5, 3: 14, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!