ID: 907407097_907407107

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 907407097 907407107
Species Human (GRCh38) Human (GRCh38)
Location 1:54260378-54260400 1:54260395-54260417
Sequence CCTCACACCTGTGTGCCCAGTGG CAGTGGTCAGGGAGGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 352} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!