ID: 907407921_907407924

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 907407921 907407924
Species Human (GRCh38) Human (GRCh38)
Location 1:54265139-54265161 1:54265152-54265174
Sequence CCATGGTCTGCCTCACCCACAGC CACCCACAGCCCCCAAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 409} {0: 1, 1: 0, 2: 1, 3: 47, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!