ID: 907424398_907424404

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 907424398 907424404
Species Human (GRCh38) Human (GRCh38)
Location 1:54370168-54370190 1:54370198-54370220
Sequence CCTTCCTGGAAGCTGGTGGCTGG GCAGGTACAGGGCTTCCAAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 51, 4: 397} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!