ID: 907426807_907426817

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 907426807 907426817
Species Human (GRCh38) Human (GRCh38)
Location 1:54384959-54384981 1:54384998-54385020
Sequence CCTCTCTGGCTAATGGTGGCCCC CTCCAGAGTAGGCCTGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!