ID: 907427019_907427030

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 907427019 907427030
Species Human (GRCh38) Human (GRCh38)
Location 1:54386343-54386365 1:54386391-54386413
Sequence CCTTCAGATAAAATGCCCCACGG CATCATCAACTCCCAGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!