ID: 907427291_907427299

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 907427291 907427299
Species Human (GRCh38) Human (GRCh38)
Location 1:54388423-54388445 1:54388444-54388466
Sequence CCCACACACAGTGCCTGGCCTGG GGGGTAAATGCAGTAAATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 334} {0: 1, 1: 0, 2: 1, 3: 8, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!