ID: 907430275_907430279

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 907430275 907430279
Species Human (GRCh38) Human (GRCh38)
Location 1:54407047-54407069 1:54407091-54407113
Sequence CCGGCGCCGAGGCGCGCGGCTGC TACTTTGGAAAACCCCAAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!