ID: 907443076_907443084

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 907443076 907443084
Species Human (GRCh38) Human (GRCh38)
Location 1:54490341-54490363 1:54490373-54490395
Sequence CCATCTCCGGGCCTCAGTTTCCC AATAGTTGGTAGCAAGAGGATGG
Strand - +
Off-target summary {0: 6, 1: 127, 2: 502, 3: 1281, 4: 2785} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!