|
Left Crispr |
Right Crispr |
| Crispr ID |
907453786 |
907453799 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:54562561-54562583
|
1:54562603-54562625
|
| Sequence |
CCTCCCGGACGGGGTGGCTGCCG |
TCTCAGATGGGGCAGCTGCCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 544, 1: 610, 2: 1355, 3: 8032, 4: 5749} |
{0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|