ID: 907490448_907490457

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 907490448 907490457
Species Human (GRCh38) Human (GRCh38)
Location 1:54805909-54805931 1:54805954-54805976
Sequence CCATATTAAATACAAGAAGGGCC AAGGACCCTGAAAATGTGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112} {0: 1, 1: 0, 2: 2, 3: 24, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!