ID: 907497420_907497422

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 907497420 907497422
Species Human (GRCh38) Human (GRCh38)
Location 1:54854099-54854121 1:54854114-54854136
Sequence CCTGCACCACGTGGTGCTGCTCG GCTGCTCGTACAGCTTGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 116} {0: 1, 1: 0, 2: 2, 3: 4, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!