ID: 907522480_907522493

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 907522480 907522493
Species Human (GRCh38) Human (GRCh38)
Location 1:55033295-55033317 1:55033341-55033363
Sequence CCAGAATGGTTGGCGAGCTCCCC CCAGCCCAGCTCTTCCTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 36} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!