ID: 907524781_907524789

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 907524781 907524789
Species Human (GRCh38) Human (GRCh38)
Location 1:55047794-55047816 1:55047819-55047841
Sequence CCCGGCCTGGGCAGCCTGTGGCC GGAGAGGACAGCTCCTCTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 85, 4: 575} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!