ID: 907527477_907527481

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 907527477 907527481
Species Human (GRCh38) Human (GRCh38)
Location 1:55062442-55062464 1:55062464-55062486
Sequence CCAAGAGACATGCTGTTCTCCCT TCCTGGAGCATCTATTTTAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 36, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!