ID: 907602960_907602967

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 907602960 907602967
Species Human (GRCh38) Human (GRCh38)
Location 1:55788504-55788526 1:55788546-55788568
Sequence CCGTATCCAGAGGGGTGGAAGTC CAGCAAAAAGCCATGGTGGACGG
Strand - +
Off-target summary {0: 1, 1: 30, 2: 75, 3: 96, 4: 161} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!