ID: 907612514_907612524

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 907612514 907612524
Species Human (GRCh38) Human (GRCh38)
Location 1:55886839-55886861 1:55886874-55886896
Sequence CCAGAAAGTATCTTAGCTTCACC TGCCTTGTGCTCTGACTGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 23, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!