ID: 907675774_907675779

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 907675774 907675779
Species Human (GRCh38) Human (GRCh38)
Location 1:56516546-56516568 1:56516594-56516616
Sequence CCTCTTCTAGTCTACTGCTGACA TCATCTGCATGAAGGCCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 138} {0: 1, 1: 0, 2: 1, 3: 18, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!