ID: 907689746_907689750

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 907689746 907689750
Species Human (GRCh38) Human (GRCh38)
Location 1:56651025-56651047 1:56651056-56651078
Sequence CCCTTGCTTGACTTGTGTGCTAG CCCTGAACAATTTAACTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 105} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!