ID: 907692884_907692901

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 907692884 907692901
Species Human (GRCh38) Human (GRCh38)
Location 1:56688181-56688203 1:56688220-56688242
Sequence CCTTCTGAAATTTGTTTCCCTTT GGTTAGGGGTGGGGGACAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 81, 4: 721} {0: 1, 1: 0, 2: 5, 3: 90, 4: 830}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!