ID: 907692899_907692902

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 907692899 907692902
Species Human (GRCh38) Human (GRCh38)
Location 1:56688213-56688235 1:56688232-56688254
Sequence CCATTGTGGTTAGGGGTGGGGGA GGGACAAAGGGAAATTTTATTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!