ID: 907714353_907714355

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 907714353 907714355
Species Human (GRCh38) Human (GRCh38)
Location 1:56913636-56913658 1:56913662-56913684
Sequence CCACTTTTTCAGGCACATAAAAC TTGTATGGTACATAAAATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 237} {0: 1, 1: 0, 2: 0, 3: 21, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!