ID: 907718511_907718515

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 907718511 907718515
Species Human (GRCh38) Human (GRCh38)
Location 1:56950311-56950333 1:56950333-56950355
Sequence CCATGAGGAGGCTGTAAGAGCAG GTGCAGGTGATGGTTGATGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 20, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!