ID: 907718511_907718516

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 907718511 907718516
Species Human (GRCh38) Human (GRCh38)
Location 1:56950311-56950333 1:56950338-56950360
Sequence CCATGAGGAGGCTGTAAGAGCAG GGTGATGGTTGATGAGGGTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 36, 4: 429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!