ID: 907727838_907727844

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 907727838 907727844
Species Human (GRCh38) Human (GRCh38)
Location 1:57036423-57036445 1:57036454-57036476
Sequence CCTGTTTGGGGCAACCTTTGGAG TGCACTTCCTCCAGCCAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!