ID: 907734471_907734479

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 907734471 907734479
Species Human (GRCh38) Human (GRCh38)
Location 1:57098450-57098472 1:57098475-57098497
Sequence CCCCCATTACCATCTAATTGGAG TTGTGTGTCTGGAGGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 207} {0: 1, 1: 0, 2: 4, 3: 65, 4: 497}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!