ID: 907738554_907738561

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 907738554 907738561
Species Human (GRCh38) Human (GRCh38)
Location 1:57140327-57140349 1:57140344-57140366
Sequence CCTCCCTCATTCTACAGATGAGG ATGAGGAAACATAAGGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 35, 3: 225, 4: 752} {0: 1, 1: 0, 2: 3, 3: 36, 4: 510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!