|
Left Crispr |
Right Crispr |
| Crispr ID |
907741439 |
907741449 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:57170070-57170092
|
1:57170118-57170140
|
| Sequence |
CCCTGCAACCTCTGCATCCCAGG |
TCCTGAGTAGCTGGGCTTACAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 174, 1: 55063, 2: 143364, 3: 230409, 4: 201912} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|