ID: 907747060_907747064

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 907747060 907747064
Species Human (GRCh38) Human (GRCh38)
Location 1:57223877-57223899 1:57223900-57223922
Sequence CCTTGCTTCTGCAGGCTGGACAG TGTGATATCATGGGGAAAACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 25, 3: 111, 4: 386} {0: 1, 1: 0, 2: 0, 3: 20, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!