ID: 907751873_907751876

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 907751873 907751876
Species Human (GRCh38) Human (GRCh38)
Location 1:57270701-57270723 1:57270747-57270769
Sequence CCTGCAATGAACACAGGAGTGTC TGTGATACTGCATTGTGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 151} {0: 1, 1: 0, 2: 2, 3: 38, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!