ID: 907762259_907762263

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 907762259 907762263
Species Human (GRCh38) Human (GRCh38)
Location 1:57372863-57372885 1:57372887-57372909
Sequence CCTTCCATGTCTACCTTAAAGAA TAAAGCAAGTCTGAGCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 236} {0: 1, 1: 0, 2: 2, 3: 50, 4: 521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!