ID: 907765245_907765250

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 907765245 907765250
Species Human (GRCh38) Human (GRCh38)
Location 1:57403357-57403379 1:57403410-57403432
Sequence CCAGCACTGAGAAGGCAAAGCTG CTCTAGCCATAGCTGCAACTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 315} {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!