ID: 907789173_907789175

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 907789173 907789175
Species Human (GRCh38) Human (GRCh38)
Location 1:57645072-57645094 1:57645098-57645120
Sequence CCAAGGTTCATCTGGATCCACAG AGCAACAGCATGTGAGTTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 312} {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!