|
Left Crispr |
Right Crispr |
Crispr ID |
907791768 |
907791774 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:57673143-57673165
|
1:57673180-57673202
|
Sequence |
CCTGGTTCATAGATGGCCATCTT |
CTCACATGACAGAAGGGGCATGG |
Strand |
- |
+ |
Off-target summary |
{0: 16, 1: 71, 2: 140, 3: 283, 4: 677} |
{0: 2, 1: 45, 2: 150, 3: 430, 4: 1147} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|