ID: 907802074_907802079

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 907802074 907802079
Species Human (GRCh38) Human (GRCh38)
Location 1:57778949-57778971 1:57778969-57778991
Sequence CCTCTTTCCCTCCTTCACTCCAC CACAAATATTCTACAGAACATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 17, 3: 208, 4: 1970} {0: 1, 1: 0, 2: 1, 3: 24, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!