ID: 907806808_907806811

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 907806808 907806811
Species Human (GRCh38) Human (GRCh38)
Location 1:57828424-57828446 1:57828462-57828484
Sequence CCTGCTGCAGTAATCTTGGGGAC ATTGTTTTTTCTTTGTGTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 106, 4: 1396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!