ID: 907811157_907811159

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 907811157 907811159
Species Human (GRCh38) Human (GRCh38)
Location 1:57871421-57871443 1:57871449-57871471
Sequence CCAGAGAAATTATCTTTCCGAAG ACAGCTAGTAAGCTTAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 295} {0: 1, 1: 0, 2: 5, 3: 18, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!